Effects of Stability of Base Pairs Containing an Oxazolone on DNA Elongation
نویسندگان
چکیده
The nucleoside 2,2,4-triamino-5(2H)-oxazolone (Oz) can result from oxidative damage to guanine residues in DNA. Despite differences among the three polymerases (Pol β, KF exo(-), and Pol η) regarding nucleotide incorporation patterns opposite Oz, all three polymerases can incorporate guanine opposite Oz. Based on ab initio calculations, we proposed a structure for a stable Oz:G base pair. Here, to assess the stability of each Oz-containing base pair (Oz:G, Oz:A, Oz:C, and Oz:T) upon DNA replication, we determined the efficiency of Pol β-, KF exo(-)-, or Pol η-catalyzed primer extension beyond each base pair. With each polymerase, extension beyond Oz:G was more efficient than that beyond Oz:A, Oz:C, or Oz:T. Moreover, thermal denaturation studies revealed that the T m value for the duplex containing Oz:G was significantly higher than those obtained for duplexes containing Oz:A, Oz:C, or Oz:T. Therefore, the results from ab initio calculations along with those from DNA replication assays and thermal denaturation experiments supported the conclusion that Oz:G is the most stable of the Oz-containing base pairs.
منابع مشابه
Calculating distortions of short DNA duplexes with base pairing between an oxidatively damaged guanine and a guanine.
DNA is constantly being oxidized, and oxidized DNA is prone to mutation; moreover, guanine is highly sensitive to several oxidative stressors. Several oxidatively damaged forms of guanine-including 2,2,4-triamino-5(2H)-oxazolone (Oz), iminoallantoin (Ia), and spiroiminodihydantoin (Sp)-can be paired with guanine, and cause G:C-C:G transversions. Previous findings indicate that guanine is incorp...
متن کاملInvestigation of Substituent Effects on the Strength of Hydrogen Bond in the Guanine: Cytosine Base Pairs: A Theoretical Study
In the present work, the substituent effect on the strength of H-bonds in the guanine – cytosine base pair was studied when the substituents are connected to the guanine base through a phenyl ring. In this study, guanine was substituted in the H8 and H9 positions by electron donating (ED) and electron withdrawing (EW) groups mediated by a phenyl ring in the gas phase. The calculations were perf...
متن کاملBase pairing involving deoxyinosine: implications for probe design.
The thermal stability of oligodeoxyribonucleotide duplexes containing deoxyinosine (I) residues matched with each of the four normal DNA bases were determined by optical melting techniques. The duplexes containing at least one I were obtained by mixing equimolar amounts of an oligonucleotide of sequence dCA3XA3G with one of sequence dCT3YT3G where X and Y were A, C, G, T, or I. Comparison of op...
متن کاملSite-resolved stabilization of a DNA triple helix by magnesium ions.
Proton exchange and NMR spectroscopy have been used to define the effects of Mg2+ ions upon the stability of individual base pairs in the intramolecular parallel triple helix formed by the DNA oligonucleotide d(GAAGAGGTTTTTCCTCTTCTTTTTCTTCTCC). The rates of exchange of individual Watson-Crick and Hoogsteen imino protons in the DNA triple helix were measured in the absence and in the presence of...
متن کاملDrought effects on elongation kinetics and sugar deposition in the elongation zone of durum wheat (Triticum durum Desf.) leaves
The aim of this study was to analyze the effect of drought stress on the kinetics of leaf elongation in relationship to the variation of sugar concentrations and their net deposition rates along the elongation zone of leaf 4 of durum wheat plants. Plants were grown in soil in a naturally illuminated greenhouse, and water...
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
عنوان ژورنال:
دوره 2014 شماره
صفحات -
تاریخ انتشار 2014